FASTA format description

A sequence in FASTA format consists of a single-line description, followed by lines of sequence data. The first character of the description line is a greater-than (">") symbol in the first column. All lines should be shorter than 80 charcters. An example sequence in FASTA format is:



>Name of the sequence
ctgcgagNcgcgcgatgatagMMM-NNNnnnnncgcggcgagcatgtagcatgctagctgtcgcgagcactUUUURRRrrrrrrr
cggccgagatcaggcgatgcatgcgcagggagcagcgagcgacgagcacagcatgctagctagatgcatgctaVvvvcgtaggcagc
cgccgagagacgatggagctgc

Sequences have to be represented in the standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions: lower-case letters are accepted and are mapped into upper-case; a single hyphen or dash can be used to represent a gap of indeterminate length; and in amino acid sequences, U and * are acceptable letters (see below). Before submitting a request, any numerical digits in the query sequence should either be removed or replaced by appropriate letter codes (e.g., N for unknown nucleic acid residue or X for unknown amino acid residue).


The nucleic acid codes supported are:

A --> adenosine M --> A C (amino)
C --> cytidine S --> G C (strong)
G --> guanine W --> A T (weak)
T --> thymidine B --> G T C
U --> uridine D --> G A T
R --> G A (purine) H --> A C T
Y --> T C (pyrimidine) V --> G C A
K --> G T (keto) N --> A G C T (any)
  - gap of indeterminate length

For those programs that use amino acid query sequences (BLASTP and TBLASTN), the accepted amino acid codes are:


A alanine P proline
B aspartate or asparagine Q glutamine
C cystine R arginine
D aspartate S serine
E glutamate T threonine
F phenylalanine U selenocysteine
G glycine V valine
H histidine W tryptophan
I isoleucine Y tyrosine
K lysine Z glutamate or glutamine
L leucine X any
M methionine * translation stop
N asparagine - gap of indeterminate length
   

 

| Back