FASTA format description

A sequence in FASTA format consists of a single-line description, followed by lines of sequence data. The first character of the description line is a greater-than (">") symbol in the first column. All lines should be shorter than 80 charcters. An example sequence in FASTA format is:



>Name of the sequence
ctgcgagNcgcgcgatgatagMMM-NNNnnnnncgcggcgagcatgtagcatgctagctgtcgcgagcactUUUURRRrrrrrrr
cggccgagatcaggcgatgcatgcgcagggagcagcgagcgacgagcacagcatgctagctagatgcatgctaVvvvcgtaggcagc
cgccgagagacgatggagctgc

Sequences have to be represented in the standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions: lower-case letters are accepted and are mapped into upper-case; a single hyphen or dash can be used to represent a gap of indeterminate length; and in amino acid sequences, U and * are acceptable letters (see below). Before submitting a request, any numerical digits in the query sequence should either be removed or replaced by appropriate letter codes (e.g., N for unknown nucleic acid residue or X for unknown amino acid residue).

The nucleic acid codes supported are:

A --> adenosine	M --> A C (amino)
C --> cytidine	S --> G C (strong)
G --> guanine	W --> A T (weak)
T --> thymidine	B --> G T C
U --> uridine	D --> G A T
R --> G A (purine)	H --> A C T
Y --> T C (pyrimidine)	V --> G C A
K --> G T (keto)	N --> A G C T (any)
	- gap of indeterminate length

For those programs that use amino acid query sequences (BLASTP and TBLASTN), the accepted amino acid codes are:

A alanine	P proline
B aspartate or asparagine	Q glutamine
C cystine	R arginine
D aspartate	S serine
E glutamate	T threonine
F phenylalanine	U selenocysteine
G glycine	V valine
H histidine	W tryptophan
I isoleucine	Y tyrosine
K lysine	Z glutamate or glutamine
L leucine	X any
M methionine	* translation stop
N asparagine	- gap of indeterminate length